(23 intermediate revisions by 3 users not shown) | |||
Line 24: | Line 24: | ||
<meta name="description" content="2017 Tongji iGEM team wiki"> | <meta name="description" content="2017 Tongji iGEM team wiki"> | ||
<meta name="viewport" content="width=device-width, initial-scale=1.0, minimum-scale=1.0"> | <meta name="viewport" content="width=device-width, initial-scale=1.0, minimum-scale=1.0"> | ||
− | <title>Tongji iGEM</title> | + | <title>Tongji iGEM - InterLab</title> |
<script src="https://2017.igem.org/Template:Tongji_China/Javascript?action=raw&ctype=text/javascript"></script> | <script src="https://2017.igem.org/Template:Tongji_China/Javascript?action=raw&ctype=text/javascript"></script> | ||
Line 48: | Line 48: | ||
margin-top: 20px; | margin-top: 20px; | ||
align-items: center; | align-items: center; | ||
− | width: | + | width: 70%; |
+ | border-radius:6px | ||
} | } | ||
.demo-card-wide > .mdl-card__title { | .demo-card-wide > .mdl-card__title { | ||
Line 58: | Line 59: | ||
color: #757575; | color: #757575; | ||
} | } | ||
+ | |||
+ | .mdl-card__title-text { | ||
+ | padding-top: 20px; | ||
+ | } | ||
+ | |||
+ | .mdl-card__supporting-text { | ||
+ | line-height: 130%; | ||
+ | } | ||
+ | |||
+ | /*@-webkit-keyframes blinker { | ||
+ | from { opacity: 1.0; } | ||
+ | to { opacity: 0.0; } | ||
+ | }*/ | ||
+ | |||
+ | .android-header .material-icons { | ||
+ | color: #388E3C !important; | ||
+ | /*-webkit-animation-name: blinker; | ||
+ | -webkit-animation-iteration-count: 5; | ||
+ | -webkit-animation-timing-function: cubic-bezier(.5, 0, 1, 1); | ||
+ | -webkit-animation-duration: 1.5s;*/ | ||
+ | } | ||
+ | |||
+ | .imagelayout{ | ||
+ | width: 60%; | ||
+ | opacity: 0.8; | ||
+ | } | ||
+ | |||
+ | .chartopacity { | ||
+ | opacity: 0.8; | ||
+ | } | ||
+ | |||
+ | @media only screen and (max-device-width: 1200px) { | ||
+ | .demo-card-wide.mdl-card { | ||
+ | width: 80%; | ||
+ | max-width: 1500px | ||
+ | } | ||
+ | } | ||
+ | |||
+ | @media only screen and (max-device-width: 900px) { | ||
+ | .demo-card-wide.mdl-card { | ||
+ | width: 90%; | ||
+ | } | ||
+ | .imagelayout { | ||
+ | width: 80%; | ||
+ | } | ||
+ | } | ||
@media only screen and (max-device-width: 600px) { | @media only screen and (max-device-width: 600px) { | ||
.demo-card-wide.mdl-card { | .demo-card-wide.mdl-card { | ||
− | |||
− | |||
− | |||
width: 95%; | width: 95%; | ||
+ | } | ||
+ | |||
+ | .imagelayout { | ||
+ | width: 100%; | ||
} | } | ||
} | } | ||
Line 81: | Line 129: | ||
window.setTimeout(closeMenuDiv,500); | window.setTimeout(closeMenuDiv,500); | ||
window.setTimeout(closeMenuDiv,1000); | window.setTimeout(closeMenuDiv,1000); | ||
+ | window.setTimeout(closeMenuDiv,5000); | ||
window.setTimeout(closeMenuDiv,10000); | window.setTimeout(closeMenuDiv,10000); | ||
</script> | </script> | ||
Line 91: | Line 140: | ||
<div class="mdl-layout__header-row"> | <div class="mdl-layout__header-row"> | ||
<span class="android-title mdl-layout-title"> | <span class="android-title mdl-layout-title"> | ||
− | <div class="logo-font"> | + | <div class="logo-font">Tongji iGEM</div> |
</span> | </span> | ||
<!-- Add spacer, to align navigation to the right in desktop --> | <!-- Add spacer, to align navigation to the right in desktop --> | ||
Line 106: | Line 155: | ||
</div> | </div> | ||
<span class="android-mobile-title mdl-layout-title"> | <span class="android-mobile-title mdl-layout-title"> | ||
− | <div class="logo-font"> | + | <div class="logo-font">Tongji iGEM</div> |
</span> | </span> | ||
</div> | </div> | ||
Line 114: | Line 163: | ||
<nav class="mdl-navigation"> | <nav class="mdl-navigation"> | ||
<!-- <span class="mdl-navigation__link" href="">Title</span> --> | <!-- <span class="mdl-navigation__link" href="">Title</span> --> | ||
− | <a class="mdl-navigation__link" | + | <a class="mdl-navigation__link" style="color: #388E3C" href="https://2017.igem.org/Team:Tongji_China">HOME</a> |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
<div class="android-drawer-separator"></div> | <div class="android-drawer-separator"></div> | ||
+ | |||
+ | <a class="mdl-navigation__link" style="color: #388E3C">PROJECT</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Description">Description</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Design">Design</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Results">Results</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Demonstrate">Demonstrate</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Record">Record</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Safety">Safety</a> | ||
+ | <!-- <div class="android-drawer-separator"></div> --> | ||
+ | |||
+ | <a class="mdl-navigation__link" style="color: #388E3C">LAB</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Parts">Parts</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Experiments">Tests</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/InterLab">InterLab</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Process">Process</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Protocol">Protocol</a> | ||
+ | <!-- <div class="android-drawer-separator"></div> --> | ||
+ | |||
+ | <a class="mdl-navigation__link" style="color: #388E3C" href="https://2017.igem.org/Team:Tongji_China/Model">MODEL</a> | ||
+ | <!-- <div class="android-drawer-separator"></div> --> | ||
+ | |||
+ | <a class="mdl-navigation__link" style="color: #388E3C" href="https://2017.igem.org/Team:Tongji_China/Human_Practices">HP</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/HP/Silver">Silver</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/HP/Gold_Integrated">Gold</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Engagement">Engagement</a> | ||
+ | <!-- <div class="android-drawer-separator"></div> --> | ||
+ | |||
+ | |||
+ | |||
+ | <a class="mdl-navigation__link" style="color: #388E3C">AWARDS</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Model">Model Award</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Judging_Form">Judging Form</a> | ||
+ | <!-- <div class="android-drawer-separator"></div> --> | ||
+ | |||
+ | <a class="mdl-navigation__link" style="color: #388E3C">TEAM</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Team">Members</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Collaborations">Collaboration</a> | ||
+ | <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Attributions">Attribution</a> | ||
<div class="android-drawer-separator"></div> | <div class="android-drawer-separator"></div> | ||
+ | <!-- <div class="android-drawer-separator"></div> --> | ||
</nav> | </nav> | ||
</div> | </div> | ||
Line 146: | Line 215: | ||
<div class="mdl-typography--text-center" style="margin-bottom:20%"> | <div class="mdl-typography--text-center" style="margin-bottom:20%"> | ||
<div class="logo-font android-slogan" style="color:#388E3C;">InterLab</div> | <div class="logo-font android-slogan" style="color:#388E3C;">InterLab</div> | ||
− | <div class="logo-font android-sub-slogan" style="color:#757575;">We partecipated in the 4<sup>th</sup> iGEM Interlab study along with about 100 teams. We have focused on quantifying the expression of GFP in common, comparable or absolute units.</div> | + | <div class="logo-font android-sub-slogan" style="color:#757575;"> |
+ | We partecipated in the 4<sup>th</sup> iGEM Interlab study along with about 100 teams.<br> | ||
+ | We have focused on quantifying the expression of GFP in common, <br>comparable or absolute units.<br> | ||
+ | <i class="material-icons">expand_more</i> | ||
+ | </div> | ||
</div> | </div> | ||
<!-- Background and Design --> | <!-- Background and Design --> | ||
− | <div class="demo-card-wide mdl-card mdl-shadow--2dp | + | <div class="demo-card-wide mdl-card mdl-shadow--2dp"> |
− | <div class="mdl-card__title"> | + | <div class="mdl-card__title" style="text-align:center"> |
<h4 class="mdl-card__title-text" style="font-size: 250%; color:#5a5a5a">Background & Design</h4> | <h4 class="mdl-card__title-text" style="font-size: 250%; color:#5a5a5a">Background & Design</h4> | ||
</div> | </div> | ||
<div class="mdl-card__supporting-text" style="font-size: 115%"> | <div class="mdl-card__supporting-text" style="font-size: 115%"> | ||
− | Our team took part in this study which aimed to standardize the measurements of fluorescence in different labs. The main task was to quantify expression of GFP in different units. In our case, we measured fluorescence using a plate reader. | + | Our team took part in this study which aimed to standardize the measurements of fluorescence in different labs. The main task was to quantify expression of GFP in different units. In our case, we measured fluorescence using a plate reader.<br><br> |
− | + | It is very common to use fluorescence as a proxy for promoter activity, and the green fluorescent protein (GFP) is the most popular protein. Although detecting the intensity of fluorescence is an indirect measurement, we can use it as representative of the expression levels of GFP. This method has a significant advantage, which is that it allows to monitor continuously without disrupting cells.<br> | |
− | + | Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell.<br><br> | |
− | It is very common to use fluorescence as a proxy for promoter activity, and the green fluorescent protein (GFP) is the most popular protein. Although detecting the intensity of fluorescence is an indirect measurement, we can use it as representative of the expression levels of GFP. This method has a significant advantage, which is that it allows to monitor continuously without disrupting cells. | + | We aim to proceed in the experiment using the supplied FITC as a standard reference material. The standard curve can be constructed by measuring the fluorescence of a dilution series. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform a relative measurements of fluorescence into an absolute measurements of GFP.<br><br> |
− | + | ||
− | + | ||
− | Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell. | + | |
− | + | ||
− | + | ||
− | We aim to proceed in the experiment using the supplied FITC as a standard reference material. The standard curve can be constructed by measuring the fluorescence of a dilution series. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform a relative measurements of fluorescence into an absolute measurements of GFP. | + | |
− | + | ||
− | + | ||
However, we aim to contain instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites. | However, we aim to contain instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites. | ||
</div> | </div> | ||
Line 173: | Line 238: | ||
<!-- Description --> | <!-- Description --> | ||
− | <div class="demo-card-wide mdl-card mdl-shadow--2dp | + | <div class="demo-card-wide mdl-card mdl-shadow--2dp"> |
− | <div class="mdl-card__title"> | + | <div class="mdl-card__title" style="text-align:center"> |
<h4 class="mdl-card__title-text" style="font-size: 250%; color:#5a5a5a">Description</h4> | <h4 class="mdl-card__title-text" style="font-size: 250%; color:#5a5a5a">Description</h4> | ||
</div> | </div> | ||
<div class="mdl-card__supporting-text" style="font-size: 115%"> | <div class="mdl-card__supporting-text" style="font-size: 115%"> | ||
− | Plasmids containing promoters and GFP were taken from The 2017 DNA Distribution Kit 7 and all devices were transformed into E. coli. | + | Plasmids containing promoters and GFP were taken from The 2017 DNA Distribution Kit 7 and all devices were transformed into E. coli.<br> |
− | + | <br>3ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol. | |
− | + | ||
− | + | ||
</div> | </div> | ||
<div class="android-drawer-separator"></div> | <div class="android-drawer-separator"></div> | ||
Line 187: | Line 250: | ||
<!-- Result --> | <!-- Result --> | ||
− | <div class="demo-card-wide mdl-card mdl-shadow--2dp | + | <div class="demo-card-wide mdl-card mdl-shadow--2dp"> |
− | <div class="mdl-card__title"> | + | <div class="mdl-card__title" style="text-align:center"> |
<h4 class="mdl-card__title-text" style="font-size: 250%; color:#5a5a5a">Results</h4> | <h4 class="mdl-card__title-text" style="font-size: 250%; color:#5a5a5a">Results</h4> | ||
</div> | </div> | ||
<div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
Sequencing | Sequencing | ||
− | <div | + | <div style="height:16px"></div> |
<table class="mdl-data-table mdl-js-data-table mdl-data-table mdl-shadow--2dp" style="margin:auto; width:100%"> | <table class="mdl-data-table mdl-js-data-table mdl-data-table mdl-shadow--2dp" style="margin:auto; width:100%"> | ||
<thead> | <thead> | ||
Line 258: | Line 321: | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
+ | <div class="android-drawer-separator"></div> | ||
</div> | </div> | ||
<div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
Table 1 - OD600 Reference Point | Table 1 - OD600 Reference Point | ||
− | <div | + | <div style="height:16px"></div> |
<table class="mdl-data-table mdl-js-data-table mdl-data-table mdl-shadow--2dp" style="margin:auto; width:100%"> | <table class="mdl-data-table mdl-js-data-table mdl-data-table mdl-shadow--2dp" style="margin:auto; width:100%"> | ||
<thead> | <thead> | ||
Line 316: | Line 380: | ||
<div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
Table 2 - FITC Standard Curve | Table 2 - FITC Standard Curve | ||
− | <div | + | <div style="height:16px"></div> |
<table class="mdl-data-table mdl-js-data-table mdl-data-table mdl-shadow--2dp" style="margin:auto; width:100%"> | <table class="mdl-data-table mdl-js-data-table mdl-data-table mdl-shadow--2dp" style="margin:auto; width:100%"> | ||
<thead> | <thead> | ||
Line 331: | Line 395: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
− | <td | + | <td> |
− | + | 50 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 61138.13773 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 65271.06373 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 64591.86073 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 65095.54373 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 64024.15148 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 1945.425461 | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <td | + | <td> |
− | + | 25 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 46595.20773 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 47958.14973 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 47759.33273 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 46973.06773 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 47321.43948 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 644.4444304 | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <td | + | <td> |
− | + | 12.5 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 28000.11673 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 29885.96173 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 29220.19473 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 29151.63573 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 29064.47723 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 783.0590871 | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <td | + | <td> |
− | + | 6.25 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 15683.49573 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 16760.13373 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 16218.20373 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 16178.31273 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 16210.03648 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 440.0474392 | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <td | + | <td> |
− | + | 3.125 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 8520.498733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 8943.591733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 8732.387733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 8904.756733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 8775.308733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 193.0857332 | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <td | + | <td> |
− | + | 1.5625 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 3763.249733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 4130.652733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 3895.511733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 4038.104733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 3956.879733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 161.3000976 | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <td | + | <td> |
− | + | 0.78125 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 1812.487733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 2054.542733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 1959.396733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 2020.259733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 1961.671733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 106.9557819 | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <td | + | <td> |
− | + | 0.390625 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 985.464733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 1054.489733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 1024.705733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 1069.755733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 1033.603983 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 37.14713908 | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <td | + | <td> |
− | + | 0.1953125 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 497.078733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 527.161733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 514.866733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 522.469733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 515.394233 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 13.21958841 | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <td | + | <td> |
− | + | 0.09765625 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 244.808733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 261.900733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 248.052733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 257.166733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 252.982233 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 7.919506613 | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <td | + | <td> |
− | + | 0.048828125 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 119.568733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 122.370733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 123.219733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 127.955733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 123.278733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 3.48646784 | |
</td> | </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | <td | + | <td> |
− | + | 0 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 0.419733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 0.411733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 0.046733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 0.241733 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 0.279983 | |
</td> | </td> | ||
− | <td | + | <td> |
− | + | 0.175837757 | |
</td> | </td> | ||
</tr> | </tr> | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
+ | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
+ | Figure 1 - Fluorescein standard curve | ||
+ | <div style="height:16px"></div> | ||
+ | <img src="https://static.igem.org/mediawiki/2017/7/76/2017tongji_image_fluorescein_standard_curve.png" style="width:100%" alt="Fluorescein standard curve"> | ||
+ | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
+ | Figure 2 - Fluorescein standard curve [log scale] | ||
+ | <div style="height:16px"></div> | ||
+ | <img src="https://static.igem.org/mediawiki/2017/8/8c/2017tongji_image_fluorescein_standard_curve_log_scale.png" style="width:100%" alt="Fluorescein standard curve [log scale]"> | ||
+ | <div class="android-drawer-separator"></div> | ||
+ | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
+ | Table 3 - Raw data of Abs600 measurement | ||
+ | <div style="height:16px"></div> | ||
+ | <table class="mdl-data-table mdl-js-data-table mdl-data-table mdl-shadow--2dp" style="margin:auto; width:100%"> | ||
+ | <thead> | ||
+ | <tr> | ||
+ | <th></th> | ||
+ | <th></th> | ||
+ | <th>0</th> | ||
+ | <th>2</th> | ||
+ | <th>4</th> | ||
+ | <th>6</th> | ||
+ | </tr> | ||
+ | </thead> | ||
+ | <tbody> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric">Negative Control</td> | ||
+ | <td class="mdl-data-table__cell--non-numeric">CLONE 1</td> | ||
+ | <td> | ||
+ | 0.0295 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.130507 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.314472 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.42238 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.031975 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.135382 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.354122 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.43548 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Positive Control | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0305 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.161232 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.351597 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.488955 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.02885 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.162257 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.417697 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.50018 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 1 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.028375 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.057732 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.148547 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.269505 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.02985 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.048457 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.112622 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.20678 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 2 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0314 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.148682 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.394347 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.46823 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.029025 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.125007 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.375497 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.43273 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 3 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.030775 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.167307 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.400422 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.456205 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.027175 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.156457 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.405647 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.483105 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 4 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0305 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.158857 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.398722 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.45088 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.03015 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.155507 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.401822 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.453755 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 5 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0362 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.163682 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.410647 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.472155 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.03205 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.142507 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.377622 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.436505 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 6 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.03545 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.176682 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.385822 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.45088 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.02795 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.153382 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.402072 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.449205 | ||
+ | </td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 75%; margin:auto">This is the average of each clone, <a href="https://static.igem.org/mediawiki/2017/2/2c/2017tongji_InterLab_Original_Data.xlsx">click here</a> to see the original data. [Excel file]</div> | ||
+ | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
+ | Figure 3 - Correction of Abs600 measurement | ||
+ | <div style="height:16px"></div> | ||
+ | <img src="https://static.igem.org/mediawiki/2017/7/76/2017tongji_image_Abs600_measurement.png" style="width:100%" alt="Correction of Abs600 measurement"> | ||
+ | <div class="android-drawer-separator"></div> | ||
+ | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
+ | Table 4 - Raw data of fluorescence measurement | ||
+ | <div style="height:16px"></div> | ||
+ | <table class="mdl-data-table mdl-js-data-table mdl-data-table mdl-shadow--2dp" style="margin:auto; width:100%"> | ||
+ | <thead> | ||
+ | <tr> | ||
+ | <th></th> | ||
+ | <th></th> | ||
+ | <th>0</th> | ||
+ | <th>2</th> | ||
+ | <th>4</th> | ||
+ | <th>6</th> | ||
+ | </tr> | ||
+ | </thead> | ||
+ | <tbody> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Negative Control | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 1.08025 | ||
+ | </td> | ||
+ | <td> | ||
+ | 2.16875 | ||
+ | </td> | ||
+ | <td> | ||
+ | 16.13602 | ||
+ | </td> | ||
+ | <td> | ||
+ | 29.83945 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 1.96175 | ||
+ | </td> | ||
+ | <td> | ||
+ | 1.974 | ||
+ | </td> | ||
+ | <td> | ||
+ | 19.02202 | ||
+ | </td> | ||
+ | <td> | ||
+ | 32.08245 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Positive Control | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 13.218 | ||
+ | </td> | ||
+ | <td> | ||
+ | 157.839 | ||
+ | </td> | ||
+ | <td> | ||
+ | 413.9833 | ||
+ | </td> | ||
+ | <td> | ||
+ | 493.0602 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 19.26725 | ||
+ | </td> | ||
+ | <td> | ||
+ | 178.7663 | ||
+ | </td> | ||
+ | <td> | ||
+ | 485.3383 | ||
+ | </td> | ||
+ | <td> | ||
+ | 578.5027 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 1 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 203.4893 | ||
+ | </td> | ||
+ | <td> | ||
+ | 515.1385 | ||
+ | </td> | ||
+ | <td> | ||
+ | 1366.608 | ||
+ | </td> | ||
+ | <td> | ||
+ | 2527.968 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 216.369 | ||
+ | </td> | ||
+ | <td> | ||
+ | 550.578 | ||
+ | </td> | ||
+ | <td> | ||
+ | 1161.084 | ||
+ | </td> | ||
+ | <td> | ||
+ | 2002.293 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 2 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 52.94075 | ||
+ | </td> | ||
+ | <td> | ||
+ | 330.942 | ||
+ | </td> | ||
+ | <td> | ||
+ | 1212.613 | ||
+ | </td> | ||
+ | <td> | ||
+ | 1625.767 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 57.626 | ||
+ | </td> | ||
+ | <td> | ||
+ | 300.5665 | ||
+ | </td> | ||
+ | <td> | ||
+ | 1104.674 | ||
+ | </td> | ||
+ | <td> | ||
+ | 1431.868 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 3 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 2.81475 | ||
+ | </td> | ||
+ | <td> | ||
+ | 4.924 | ||
+ | </td> | ||
+ | <td> | ||
+ | 32.52677 | ||
+ | </td> | ||
+ | <td> | ||
+ | 47.32195 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 3.3015 | ||
+ | </td> | ||
+ | <td> | ||
+ | 4.3785 | ||
+ | </td> | ||
+ | <td> | ||
+ | 31.76152 | ||
+ | </td> | ||
+ | <td> | ||
+ | 56.2147 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 4 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 2.65525 | ||
+ | </td> | ||
+ | <td> | ||
+ | 6.173 | ||
+ | </td> | ||
+ | <td> | ||
+ | 34.00727 | ||
+ | </td> | ||
+ | <td> | ||
+ | 45.5552 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 2.00575 | ||
+ | </td> | ||
+ | <td> | ||
+ | 5.008 | ||
+ | </td> | ||
+ | <td> | ||
+ | 37.20552 | ||
+ | </td> | ||
+ | <td> | ||
+ | 51.47795 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 5 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 19.70225 | ||
+ | </td> | ||
+ | <td> | ||
+ | 167.6278 | ||
+ | </td> | ||
+ | <td> | ||
+ | 435.9625 | ||
+ | </td> | ||
+ | <td> | ||
+ | 529.8542 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 17.1425 | ||
+ | </td> | ||
+ | <td> | ||
+ | 140.0155 | ||
+ | </td> | ||
+ | <td> | ||
+ | 430.8645 | ||
+ | </td> | ||
+ | <td> | ||
+ | 498.9205 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 6 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 3.124 | ||
+ | </td> | ||
+ | <td> | ||
+ | 5.37275 | ||
+ | </td> | ||
+ | <td> | ||
+ | 19.22877 | ||
+ | </td> | ||
+ | <td> | ||
+ | 30.8587 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | CLONE 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 1.186134 | ||
+ | </td> | ||
+ | <td> | ||
+ | 5.4735 | ||
+ | </td> | ||
+ | <td> | ||
+ | 27.23052 | ||
+ | </td> | ||
+ | <td> | ||
+ | 39.53995 | ||
+ | </td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 75%; margin:auto">This is the average of each clone, <a href="https://static.igem.org/mediawiki/2017/2/2c/2017tongji_InterLab_Original_Data.xlsx">click here</a> to see the original data. [Excel file]</div> | ||
+ | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
+ | Figure 4 - Correction of fluorescence measurement | ||
+ | <div style="height:16px"></div> | ||
+ | <img src="https://static.igem.org/mediawiki/2017/8/8d/2017tongji_image_FI_measurement.png" style="width:100%" alt="Correction of fluorescence measurement"> | ||
+ | <div class="android-drawer-separator"></div> | ||
+ | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
+ | Table 5 - Raw data of Fl/Abs600 | ||
+ | <div style="height:16px"></div> | ||
+ | <table class="mdl-data-table mdl-js-data-table mdl-data-table mdl-shadow--2dp" style="margin:auto; width:100%"> | ||
+ | <thead> | ||
+ | <tr> | ||
+ | <th></th> | ||
+ | <th></th> | ||
+ | <th>0H</th> | ||
+ | <th>2H</th> | ||
+ | <th>4H</th> | ||
+ | <th>6H</th> | ||
+ | </tr> | ||
+ | </thead> | ||
+ | <tbody> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Negative Control | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | Colony 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0049 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0021 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0066 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0091 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | Colony 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0080 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0019 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0070 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0095 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Positive Control | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | Colony 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0559 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.1265 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.1525 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.1303 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | Colony 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0866 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.1422 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.1501 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.1493 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 1 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | Colony 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.9270 | ||
+ | </td> | ||
+ | <td> | ||
+ | 1.1547 | ||
+ | </td> | ||
+ | <td> | ||
+ | 1.1894 | ||
+ | </td> | ||
+ | <td> | ||
+ | 1.2126 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | Colony 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.9366 | ||
+ | </td> | ||
+ | <td> | ||
+ | 1.4767 | ||
+ | </td> | ||
+ | <td> | ||
+ | 1.3349 | ||
+ | </td> | ||
+ | <td> | ||
+ | 1.2506 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 2 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | Colony 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.2177 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.2875 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.3997 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.4487 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | Colony 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.2583 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.3105 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.3807 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.4273 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 3 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | Colony 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0118 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0038 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0104 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0133 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | Colony 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0166 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0036 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0102 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0150 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 4 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | Colony 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0114 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0050 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0109 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0130 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | Colony 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0089 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0042 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0120 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0146 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 5 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | Colony 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0710 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.1324 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.1375 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.1449 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | Colony 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0685 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.1269 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.1476 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.1476 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td rowspan="2" class="mdl-data-table__cell--non-numeric"> | ||
+ | Test Device 6 | ||
+ | </td> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | Colony 1 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0113 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0039 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0064 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0088 | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric"> | ||
+ | Colony 2 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0055 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0046 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0087 | ||
+ | </td> | ||
+ | <td> | ||
+ | 0.0114 | ||
+ | </td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 75%; margin:auto">This is the average of each clone, <a href="https://static.igem.org/mediawiki/2017/2/2c/2017tongji_InterLab_Original_Data.xlsx">click here</a> to see the original data. [Excel file]</div> | ||
+ | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
+ | Figure 5 - Average level of devices | ||
+ | <div style="height:16px"></div> | ||
+ | <img src="https://static.igem.org/mediawiki/2017/3/39/2017tongji_image_FI_over_Abs600.png" style="width:100%" alt="Correction of fluorescence measurement"> | ||
+ | <div class="android-drawer-separator"></div> | ||
+ | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 135%; text-align:center"> | ||
+ | Conclusions | ||
+ | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%"> | ||
+ | It is noticeable that the promoter of the Device 1 is the strongest followed by the promoters of the devices 2 and 5. But the device 3, 4 and 6 are not active. | ||
</div> | </div> | ||
<div class="android-drawer-separator"></div> | <div class="android-drawer-separator"></div> | ||
Line 613: | Line 1,653: | ||
<!-- Methods and Materials --> | <!-- Methods and Materials --> | ||
− | <div class="demo-card-wide mdl-card mdl-shadow--2dp | + | <div class="demo-card-wide mdl-card mdl-shadow--2dp"> |
− | <div class="mdl-card__title"> | + | <div class="mdl-card__title" style="text-align:center"> |
<h4 class="mdl-card__title-text" style="font-size: 250%; color:#5a5a5a">Methods & Materials</h4> | <h4 class="mdl-card__title-text" style="font-size: 250%; color:#5a5a5a">Methods & Materials</h4> | ||
</div> | </div> | ||
<div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
− | Strain used: E. coli DH5-alpha | + | Strain used: E. coli DH5-alpha<br> |
− | + | <br>Plasmid DNA (100 pg/uL in 10uL of water) | |
− | + | <div class="mdl-card__supporting-text" style="font-size: 75%; margin:auto; white-space: pre-line">Positive Control (BBa_I20270): J23151.B0032.E0040.B0010.B0012 in pSB1C3 | |
− | + | ||
− | <div class="mdl-card__supporting-text" style="font-size: 75%; margin:auto | + | |
− | + | ||
Negative Control (BBa_R0040): R0040 in pSB1C3 | Negative Control (BBa_R0040): R0040 in pSB1C3 | ||
Test Device 1 (BBa_J364000): J23101.B0034.E0040.B0010.B0012 in pSB1C3 | Test Device 1 (BBa_J364000): J23101.B0034.E0040.B0010.B0012 in pSB1C3 | ||
Line 632: | Line 1,669: | ||
Test Device 6 (BBa_J364005): J23117.J364100.E0040.B0010.B0012 in pSB1C3 | Test Device 6 (BBa_J364005): J23117.J364100.E0040.B0010.B0012 in pSB1C3 | ||
</div> | </div> | ||
− | + | <br>Materials</br> | |
− | + | <div class="mdl-card__supporting-text" style="font-size: 75%; margin:auto; white-space: pre-line;">FITC Standard: one tube with dried down FITC for creating a FITC standard | |
− | + | ||
− | <div class="mdl-card__supporting-text" style="font-size: 75%; margin:auto | + | |
− | + | ||
LUDOX: one tube with 30% colloidal silica suspended in 1mL of water | LUDOX: one tube with 30% colloidal silica suspended in 1mL of water | ||
1xPBS (phosphate buffered saline) | 1xPBS (phosphate buffered saline) | ||
Line 653: | Line 1,687: | ||
Calibration: OD600 Reference point and FITC fluorescence standard curve | Calibration: OD600 Reference point and FITC fluorescence standard curve | ||
Cell measurement: Transformation and Measurements | Cell measurement: Transformation and Measurements | ||
+ | <a href="https://static.igem.org/mediawiki/2017/c/c7/2017tongji_InterLab_2017_Plate_Reader_Protocol.pdf">Protocol for calibration and measurement</a> | ||
+ | <a href="https://static.igem.org/mediawiki/2017/2/2c/2017tongji_InterLab_Original_Data.xlsx">Raw Data</a> | ||
</div> | </div> | ||
<div class="android-drawer-separator"></div> | <div class="android-drawer-separator"></div> | ||
</div> | </div> | ||
+ | <!-- HERE ENDS THE PAGE --> | ||
+ | <!-- Go back Home --> | ||
<div class="android-wear-section" style="height:250px"> | <div class="android-wear-section" style="height:250px"> | ||
<div class="android-wear-band"> | <div class="android-wear-band"> | ||
<div class="android-wear-band-text"> | <div class="android-wear-band-text"> | ||
− | <div class="mdl-typography--display-2 mdl-typography--font-thin"> | + | <div class="mdl-typography--display-2 mdl-typography--font-thin">Ignis Fly</div> |
− | <p class="mdl-typography--headline mdl-typography--font-thin"> | + | <p class="mdl-typography--headline mdl-typography--font-thin" style="margin-bottom:0px"> |
− | + | Tongji_China iGEM 2017 Team<br> | |
− | + | <a class="mdl-typography--font-regular mdl-typography--text-uppercase android-alt-link" href="https://2017.igem.org/Team:Tongji_China/Process">Process<i class="material-icons">chevron_right</i> | |
− | + | </a> | |
− | + | ||
− | + | ||
− | + | ||
</p> | </p> | ||
</div> | </div> | ||
Line 673: | Line 1,708: | ||
</div> | </div> | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
</div> | </div> | ||
</div> | </div> | ||
</body> | </body> | ||
</html> | </html> |
Latest revision as of 00:37, 2 November 2017
Tongji iGEM
Tongji iGEM
InterLab
We partecipated in the 4th iGEM Interlab study along with about 100 teams.
We have focused on quantifying the expression of GFP in common,
comparable or absolute units.
expand_more
We have focused on quantifying the expression of GFP in common,
comparable or absolute units.
expand_more
Background & Design
Our team took part in this study which aimed to standardize the measurements of fluorescence in different labs. The main task was to quantify expression of GFP in different units. In our case, we measured fluorescence using a plate reader.
It is very common to use fluorescence as a proxy for promoter activity, and the green fluorescent protein (GFP) is the most popular protein. Although detecting the intensity of fluorescence is an indirect measurement, we can use it as representative of the expression levels of GFP. This method has a significant advantage, which is that it allows to monitor continuously without disrupting cells.
Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell.
We aim to proceed in the experiment using the supplied FITC as a standard reference material. The standard curve can be constructed by measuring the fluorescence of a dilution series. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform a relative measurements of fluorescence into an absolute measurements of GFP.
However, we aim to contain instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites.
It is very common to use fluorescence as a proxy for promoter activity, and the green fluorescent protein (GFP) is the most popular protein. Although detecting the intensity of fluorescence is an indirect measurement, we can use it as representative of the expression levels of GFP. This method has a significant advantage, which is that it allows to monitor continuously without disrupting cells.
Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell.
We aim to proceed in the experiment using the supplied FITC as a standard reference material. The standard curve can be constructed by measuring the fluorescence of a dilution series. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform a relative measurements of fluorescence into an absolute measurements of GFP.
However, we aim to contain instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites.
Description
Plasmids containing promoters and GFP were taken from The 2017 DNA Distribution Kit 7 and all devices were transformed into E. coli.
3ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol.
3ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol.
Results
Sequencing
Length | Sequence | |
---|---|---|
BBa_R0040 Part-only sequence | 54 bp | tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac |
BBa_J23101 Part-only sequence | 35 bp | tttacagctagctcagtcctaggtattatgctagc |
BBa_J23106 Part-only sequence | 35 bp | ttacggctagctcagtcctaggtatagtgctagc |
BBa_J23117 Part-only sequence | 35 bp | ttgacagctagctcagtcctagggattgtgctagc |
BBa_J364100 Part-only sequence | 84 bp | gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttct |
BBa_B0010 Part-only sequence | 80 bp | ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc |
BBa_B0012 Part-only sequence | 41 bp | tcacactggctcaccttcgggtgggcctttctgcgtttata |
BBa_E0040 Part-only sequence | 720 bp | atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtg atgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaa acttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtc actactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatg actttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaaga tgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaataga atcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaat acaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagt taacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaa caaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacac aatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgt aacagctgctgggattacacatggcatggatgaactatacaaataataa |
Table 1 - OD600 Reference Point
LUDOX-HS40 | H2O | |
---|---|---|
Replicate 1 | 0.00624 | -0.00726 |
Replicate 2 | 0.00684 | -0.00526 |
Replicate 3 | 0.00734 | -0.00366 |
Replicate 4 | 0.01104 | -0.00476 |
Arithmetic Mean | 0.007865 | -0.00524 |
Corrected Abs600 | 0.0131 | |
Reference OD600 | 0.0425 | |
OD600/Abs600 | 3.244275 |
Table 2 - FITC Standard Curve
uM Fluorescein | Replicate 1 | Replicate 2 | Replicate 3 | Replicate 4 | Arith. Mean | Arith. Std.Dev. |
---|---|---|---|---|---|---|
50 | 61138.13773 | 65271.06373 | 64591.86073 | 65095.54373 | 64024.15148 | 1945.425461 |
25 | 46595.20773 | 47958.14973 | 47759.33273 | 46973.06773 | 47321.43948 | 644.4444304 |
12.5 | 28000.11673 | 29885.96173 | 29220.19473 | 29151.63573 | 29064.47723 | 783.0590871 |
6.25 | 15683.49573 | 16760.13373 | 16218.20373 | 16178.31273 | 16210.03648 | 440.0474392 |
3.125 | 8520.498733 | 8943.591733 | 8732.387733 | 8904.756733 | 8775.308733 | 193.0857332 |
1.5625 | 3763.249733 | 4130.652733 | 3895.511733 | 4038.104733 | 3956.879733 | 161.3000976 |
0.78125 | 1812.487733 | 2054.542733 | 1959.396733 | 2020.259733 | 1961.671733 | 106.9557819 |
0.390625 | 985.464733 | 1054.489733 | 1024.705733 | 1069.755733 | 1033.603983 | 37.14713908 |
0.1953125 | 497.078733 | 527.161733 | 514.866733 | 522.469733 | 515.394233 | 13.21958841 |
0.09765625 | 244.808733 | 261.900733 | 248.052733 | 257.166733 | 252.982233 | 7.919506613 |
0.048828125 | 119.568733 | 122.370733 | 123.219733 | 127.955733 | 123.278733 | 3.48646784 |
0 | 0.419733 | 0.411733 | 0.046733 | 0.241733 | 0.279983 | 0.175837757 |
Figure 1 - Fluorescein standard curve
Figure 2 - Fluorescein standard curve [log scale]
Table 3 - Raw data of Abs600 measurement
0 | 2 | 4 | 6 | ||
---|---|---|---|---|---|
Negative Control | CLONE 1 | 0.0295 | 0.130507 | 0.314472 | 0.42238 |
CLONE 2 | 0.031975 | 0.135382 | 0.354122 | 0.43548 | |
Positive Control | CLONE 1 | 0.0305 | 0.161232 | 0.351597 | 0.488955 |
CLONE 2 | 0.02885 | 0.162257 | 0.417697 | 0.50018 | |
Test Device 1 | CLONE 1 | 0.028375 | 0.057732 | 0.148547 | 0.269505 |
CLONE 2 | 0.02985 | 0.048457 | 0.112622 | 0.20678 | |
Test Device 2 | CLONE 1 | 0.0314 | 0.148682 | 0.394347 | 0.46823 |
CLONE 2 | 0.029025 | 0.125007 | 0.375497 | 0.43273 | |
Test Device 3 | CLONE 1 | 0.030775 | 0.167307 | 0.400422 | 0.456205 |
CLONE 2 | 0.027175 | 0.156457 | 0.405647 | 0.483105 | |
Test Device 4 | CLONE 1 | 0.0305 | 0.158857 | 0.398722 | 0.45088 |
CLONE 2 | 0.03015 | 0.155507 | 0.401822 | 0.453755 | |
Test Device 5 | CLONE 1 | 0.0362 | 0.163682 | 0.410647 | 0.472155 |
CLONE 2 | 0.03205 | 0.142507 | 0.377622 | 0.436505 | |
Test Device 6 | CLONE 1 | 0.03545 | 0.176682 | 0.385822 | 0.45088 |
CLONE 2 | 0.02795 | 0.153382 | 0.402072 | 0.449205 |
This is the average of each clone, click here to see the original data. [Excel file]
Figure 3 - Correction of Abs600 measurement
Table 4 - Raw data of fluorescence measurement
0 | 2 | 4 | 6 | ||
---|---|---|---|---|---|
Negative Control | CLONE 1 | 1.08025 | 2.16875 | 16.13602 | 29.83945 |
CLONE 2 | 1.96175 | 1.974 | 19.02202 | 32.08245 | |
Positive Control | CLONE 1 | 13.218 | 157.839 | 413.9833 | 493.0602 |
CLONE 2 | 19.26725 | 178.7663 | 485.3383 | 578.5027 | |
Test Device 1 | CLONE 1 | 203.4893 | 515.1385 | 1366.608 | 2527.968 |
CLONE 2 | 216.369 | 550.578 | 1161.084 | 2002.293 | |
Test Device 2 | CLONE 1 | 52.94075 | 330.942 | 1212.613 | 1625.767 |
CLONE 2 | 57.626 | 300.5665 | 1104.674 | 1431.868 | |
Test Device 3 | CLONE 1 | 2.81475 | 4.924 | 32.52677 | 47.32195 |
CLONE 2 | 3.3015 | 4.3785 | 31.76152 | 56.2147 | |
Test Device 4 | CLONE 1 | 2.65525 | 6.173 | 34.00727 | 45.5552 |
CLONE 2 | 2.00575 | 5.008 | 37.20552 | 51.47795 | |
Test Device 5 | CLONE 1 | 19.70225 | 167.6278 | 435.9625 | 529.8542 |
CLONE 2 | 17.1425 | 140.0155 | 430.8645 | 498.9205 | |
Test Device 6 | CLONE 1 | 3.124 | 5.37275 | 19.22877 | 30.8587 |
CLONE 2 | 1.186134 | 5.4735 | 27.23052 | 39.53995 |
This is the average of each clone, click here to see the original data. [Excel file]
Figure 4 - Correction of fluorescence measurement
Table 5 - Raw data of Fl/Abs600
0H | 2H | 4H | 6H | ||
---|---|---|---|---|---|
Negative Control | Colony 1 | 0.0049 | 0.0021 | 0.0066 | 0.0091 |
Colony 2 | 0.0080 | 0.0019 | 0.0070 | 0.0095 | |
Positive Control | Colony 1 | 0.0559 | 0.1265 | 0.1525 | 0.1303 |
Colony 2 | 0.0866 | 0.1422 | 0.1501 | 0.1493 | |
Test Device 1 | Colony 1 | 0.9270 | 1.1547 | 1.1894 | 1.2126 |
Colony 2 | 0.9366 | 1.4767 | 1.3349 | 1.2506 | |
Test Device 2 | Colony 1 | 0.2177 | 0.2875 | 0.3997 | 0.4487 |
Colony 2 | 0.2583 | 0.3105 | 0.3807 | 0.4273 | |
Test Device 3 | Colony 1 | 0.0118 | 0.0038 | 0.0104 | 0.0133 |
Colony 2 | 0.0166 | 0.0036 | 0.0102 | 0.0150 | |
Test Device 4 | Colony 1 | 0.0114 | 0.0050 | 0.0109 | 0.0130 |
Colony 2 | 0.0089 | 0.0042 | 0.0120 | 0.0146 | |
Test Device 5 | Colony 1 | 0.0710 | 0.1324 | 0.1375 | 0.1449 |
Colony 2 | 0.0685 | 0.1269 | 0.1476 | 0.1476 | |
Test Device 6 | Colony 1 | 0.0113 | 0.0039 | 0.0064 | 0.0088 |
Colony 2 | 0.0055 | 0.0046 | 0.0087 | 0.0114 |
This is the average of each clone, click here to see the original data. [Excel file]
Figure 5 - Average level of devices
Conclusions
It is noticeable that the promoter of the Device 1 is the strongest followed by the promoters of the devices 2 and 5. But the device 3, 4 and 6 are not active.
Methods & Materials
Strain used: E. coli DH5-alpha
Plasmid DNA (100 pg/uL in 10uL of water)
Materials
Plasmid DNA (100 pg/uL in 10uL of water)
Positive Control (BBa_I20270): J23151.B0032.E0040.B0010.B0012 in pSB1C3
Negative Control (BBa_R0040): R0040 in pSB1C3
Test Device 1 (BBa_J364000): J23101.B0034.E0040.B0010.B0012 in pSB1C3
Test Device 2 (BBa_J364001): J23106.B0034.E0040.B0010.B0012 in pSB1C3
Test Device 3 (BBa_J364002): J23117.B0034.E0040.B0010.B0012 in pSB1C3
Test Device 4 (BBa_J364003): J23101.J364100.E0040.B0010.B0012 in pSB1C3
Test Device 5 (BBa_J364004): J23106.J364100.E0040.B0010.B0012 in pSB1C3
Test Device 6 (BBa_J364005): J23117.J364100.E0040.B0010.B0012 in pSB1C3
Materials
FITC Standard: one tube with dried down FITC for creating a FITC standard
LUDOX: one tube with 30% colloidal silica suspended in 1mL of water
1xPBS (phosphate buffered saline)
LB (Luria Bertani) media
Chloramphenicol (stock concentration 25 mg/mL dissolved in EtOH)
50 ml Falcon tube (or equivalent) or 250 ml shake flask for cell growth
1.5 ml eppendorf tubes for sample storage
Ice bucket with ice
Pipettes
Black 96 well plate
Machines: SpectraMax M5, SPX-150B-Z biochemical incubator and THZ-312 Thermostatic oscillator
Software: Microsoft Excel and pro5
Calibration: OD600 Reference point and FITC fluorescence standard curve
Cell measurement: Transformation and Measurements
Protocol for calibration and measurement
Raw Data
Ignis Fly
Tongji_China iGEM 2017 Team
Processchevron_right