Difference between revisions of "Team:Tongji China/InterLab"

 
(3 intermediate revisions by 2 users not shown)
Line 155: Line 155:
 
           </div>
 
           </div>
 
           <span class="android-mobile-title mdl-layout-title">
 
           <span class="android-mobile-title mdl-layout-title">
−
             <div class="logo-font">TongJi iGEM</div>
+
             <div class="logo-font">Tongji iGEM</div>
 
           </span>
 
           </span>
 
         </div>
 
         </div>
Line 172: Line 172:
 
           <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Demonstrate">Demonstrate</a>
 
           <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Demonstrate">Demonstrate</a>
 
           <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Record">Record</a>
 
           <a class="mdl-navigation__link" style="margin-left:8px;" href="https://2017.igem.org/Team:Tongji_China/Record">Record</a>
−
           <a class="mdl-navigation__link" style="margin-left:8px;"  href="https://2017.igem.org/Team:Tongji_China/Safety">SAFETY</a>
+
           <a class="mdl-navigation__link" style="margin-left:8px;"  href="https://2017.igem.org/Team:Tongji_China/Safety">Safety</a>
 
           <!-- <div class="android-drawer-separator"></div> -->
 
           <!-- <div class="android-drawer-separator"></div> -->
  
Line 213: Line 213:
 
         <a name="top"></a>
 
         <a name="top"></a>
 
         <!-- Title and Subtitle -->
 
         <!-- Title and Subtitle -->
−
<div class="mdl-typography--text-center mobileview-title" style="height:600px; background:url('https://static.igem.org/mediawiki/2017/c/c2/2017tongji_wiki_image_background.png') center no-repeat; background-size:cover;">
 
 
         <div class="mdl-typography--text-center" style="margin-bottom:20%">
 
         <div class="mdl-typography--text-center" style="margin-bottom:20%">
 
           <div class="logo-font android-slogan" style="color:#388E3C;">InterLab</div>
 
           <div class="logo-font android-slogan" style="color:#388E3C;">InterLab</div>
 
           <div class="logo-font android-sub-slogan" style="color:#757575;">
 
           <div class="logo-font android-sub-slogan" style="color:#757575;">
 
             We partecipated in the 4<sup>th</sup> iGEM Interlab study along with about 100 teams.<br>
 
             We partecipated in the 4<sup>th</sup> iGEM Interlab study along with about 100 teams.<br>
−
             We have focused on quantifying the expression of GFP in common, comparable or absolute units.<br>
+
             We have focused on quantifying the expression of GFP in common, <br>comparable or absolute units.<br>
 
             <i class="material-icons">expand_more</i>
 
             <i class="material-icons">expand_more</i>
 
           </div>
 
           </div>
 
         </div>
 
         </div>
−
</div>
 
  
 
         <!-- Background and Design -->
 
         <!-- Background and Design -->
Line 1,702: Line 1,700:
 
               <div class="mdl-typography--display-2 mdl-typography--font-thin">Ignis Fly</div>
 
               <div class="mdl-typography--display-2 mdl-typography--font-thin">Ignis Fly</div>
 
               <p class="mdl-typography--headline mdl-typography--font-thin" style="margin-bottom:0px">
 
               <p class="mdl-typography--headline mdl-typography--font-thin" style="margin-bottom:0px">
−
               2017 Tongji_china iGEM Team
+
               Tongji_China iGEM 2017 Team<br>
−
              </p>
+
              <a class="mdl-typography--font-regular mdl-typography--text-uppercase android-alt-link" href="https://2017.igem.org/Team:Tongji_China/Process">Process<i class="material-icons">chevron_right</i>
−
              <p>
+
              </a>
−
                <a class="mdl-typography--font-regular mdl-typography--text-uppercase android-alt-link" href="">
+
−
                  Home&nbsp;<i class="material-icons">chevron_right</i>
+
−
                </a>
+
 
               </p>
 
               </p>
 
             </div>
 
             </div>
Line 1,713: Line 1,708:
 
         </div>
 
         </div>
  
−
        <footer class="android-footer mdl-mega-footer">
 
−
          <div class="mdl-mega-footer--top-section">
 
−
            <!-- <div class="mdl-mega-footer--left-section">
 
−
              <button class="mdl-mega-footer--social-btn"></button>
 
−
              &nbsp;
 
−
              <button class="mdl-mega-footer--social-btn"></button>
 
−
              &nbsp;
 
−
              <button class="mdl-mega-footer--social-btn"></button>
 
−
            </div> -->
 
−
            <div class="mdl-mega-footer--right-section">
 
−
              <a class="mdl-typography--font-light" href="#top">
 
−
                Back to Top
 
−
                <i class="material-icons">expand_less</i>
 
−
              </a>
 
−
            </div>
 
−
          </div>
 
−
 
−
          <div class="mdl-mega-footer--middle-section">
 
−
            <p class="mdl-typography--font-light" style="text-align:right">This page was adapted from a template from getmdl.io</p>
 
−
          </div>
 
−
 
−
          <!-- <div class="mdl-mega-footer--bottom-section">
 
−
            <a class="android-link android-link-menu mdl-typography--font-light" id="version-dropdown">
 
−
              iGEM quicklinks
 
−
              <i class="material-icons">arrow_drop_up</i>
 
−
            </a>
 
−
            <ul class="mdl-menu mdl-js-menu mdl-menu--top-left mdl-js-ripple-effect" for="version-dropdown">
 
−
              <li class="mdl-menu__item" href="https://2017.igem.org/Main_Page">Home Page</li>
 
−
              <li class="mdl-menu__item" href="https://twitter.com/iGEM">Twitter</li>
 
−
              <li class="mdl-menu__item" href="https://www.instagram.com/igem_hq/">Instagram</li>
 
−
              <li class="mdl-menu__item" href="https://www.facebook.com/iGEMFoundation/">Facebook</li>
 
−
            </ul>
 
−
            <a class="android-link android-link-menu mdl-typography--font-light" id="developers-dropdown">
 
−
              Another expandable
 
−
              <i class="material-icons">arrow_drop_up</i>
 
−
            </a>
 
−
            <ul class="mdl-menu mdl-js-menu mdl-menu--top-left mdl-js-ripple-effect" for="developers-dropdown">
 
−
              <li class="mdl-menu__item" href="">Info</li>
 
−
              <li class="mdl-menu__item" href="">Info 2</li>
 
−
              <li class="mdl-menu__item" href="">More</li>
 
−
              <li class="mdl-menu__item" href="">More2</li>
 
−
            </ul>
 
−
            <a class="android-link mdl-typography--font-light" href="">Blog</a>
 
−
            <a class="android-link mdl-typography--font-light" href="">Privacy Policy</a>
 
−
          </div> -->
 
−
 
−
        </footer>
 
 
       </div>
 
       </div>
 
     </div>
 
     </div>
 
   </body>
 
   </body>
 
</html>
 
</html>

Latest revision as of 00:37, 2 November 2017


Tongji iGEM - InterLab
Tongji iGEM
Tongji iGEM
InterLab
We partecipated in the 4th iGEM Interlab study along with about 100 teams.
We have focused on quantifying the expression of GFP in common,
comparable or absolute units.
expand_more

Background & Design

Our team took part in this study which aimed to standardize the measurements of fluorescence in different labs. The main task was to quantify expression of GFP in different units. In our case, we measured fluorescence using a plate reader.

It is very common to use fluorescence as a proxy for promoter activity, and the green fluorescent protein (GFP) is the most popular protein. Although detecting the intensity of fluorescence is an indirect measurement, we can use it as representative of the expression levels of GFP. This method has a significant advantage, which is that it allows to monitor continuously without disrupting cells.
Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell.

We aim to proceed in the experiment using the supplied FITC as a standard reference material. The standard curve can be constructed by measuring the fluorescence of a dilution series. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform a relative measurements of fluorescence into an absolute measurements of GFP.

However, we aim to contain instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites.

Description

Plasmids containing promoters and GFP were taken from The 2017 DNA Distribution Kit 7 and all devices were transformed into E. coli.

3ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol.

Results

Sequencing
Length Sequence
BBa_R0040 Part-only sequence 54 bp tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac
BBa_J23101 Part-only sequence 35 bp tttacagctagctcagtcctaggtattatgctagc
BBa_J23106 Part-only sequence 35 bp ttacggctagctcagtcctaggtatagtgctagc
BBa_J23117 Part-only sequence 35 bp ttgacagctagctcagtcctagggattgtgctagc
BBa_J364100 Part-only sequence 84 bp gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttct
BBa_B0010 Part-only sequence 80 bp ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc
BBa_B0012 Part-only sequence 41 bp tcacactggctcaccttcgggtgggcctttctgcgtttata
BBa_E0040 Part-only sequence 720 bp atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtg atgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaa acttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtc actactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatg actttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaaga tgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaataga atcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaat acaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagt taacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaa caaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacac aatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgt aacagctgctgggattacacatggcatggatgaactatacaaataataa
Table 1 - OD600 Reference Point
LUDOX-HS40 H2O
Replicate 1 0.00624 -0.00726
Replicate 2 0.00684 -0.00526
Replicate 3 0.00734 -0.00366
Replicate 4 0.01104 -0.00476
Arithmetic Mean 0.007865 -0.00524
Corrected Abs600 0.0131
Reference OD600 0.0425
OD600/Abs600 3.244275
Table 2 - FITC Standard Curve
uM Fluorescein Replicate 1 Replicate 2 Replicate 3 Replicate 4 Arith. Mean Arith. Std.Dev.
50 61138.13773 65271.06373 64591.86073 65095.54373 64024.15148 1945.425461
25 46595.20773 47958.14973 47759.33273 46973.06773 47321.43948 644.4444304
12.5 28000.11673 29885.96173 29220.19473 29151.63573 29064.47723 783.0590871
6.25 15683.49573 16760.13373 16218.20373 16178.31273 16210.03648 440.0474392
3.125 8520.498733 8943.591733 8732.387733 8904.756733 8775.308733 193.0857332
1.5625 3763.249733 4130.652733 3895.511733 4038.104733 3956.879733 161.3000976
0.78125 1812.487733 2054.542733 1959.396733 2020.259733 1961.671733 106.9557819
0.390625 985.464733 1054.489733 1024.705733 1069.755733 1033.603983 37.14713908
0.1953125 497.078733 527.161733 514.866733 522.469733 515.394233 13.21958841
0.09765625 244.808733 261.900733 248.052733 257.166733 252.982233 7.919506613
0.048828125 119.568733 122.370733 123.219733 127.955733 123.278733 3.48646784
0 0.419733 0.411733 0.046733 0.241733 0.279983 0.175837757
Figure 1 - Fluorescein standard curve
Fluorescein standard curve
Figure 2 - Fluorescein standard curve [log scale]
Fluorescein standard curve [log scale]
Table 3 - Raw data of Abs600 measurement
0 2 4 6
Negative Control CLONE 1 0.0295 0.130507 0.314472 0.42238
CLONE 2 0.031975 0.135382 0.354122 0.43548
Positive Control CLONE 1 0.0305 0.161232 0.351597 0.488955
CLONE 2 0.02885 0.162257 0.417697 0.50018
Test Device 1 CLONE 1 0.028375 0.057732 0.148547 0.269505
CLONE 2 0.02985 0.048457 0.112622 0.20678
Test Device 2 CLONE 1 0.0314 0.148682 0.394347 0.46823
CLONE 2 0.029025 0.125007 0.375497 0.43273
Test Device 3 CLONE 1 0.030775 0.167307 0.400422 0.456205
CLONE 2 0.027175 0.156457 0.405647 0.483105
Test Device 4 CLONE 1 0.0305 0.158857 0.398722 0.45088
CLONE 2 0.03015 0.155507 0.401822 0.453755
Test Device 5 CLONE 1 0.0362 0.163682 0.410647 0.472155
CLONE 2 0.03205 0.142507 0.377622 0.436505
Test Device 6 CLONE 1 0.03545 0.176682 0.385822 0.45088
CLONE 2 0.02795 0.153382 0.402072 0.449205
This is the average of each clone, click here to see the original data. [Excel file]
Figure 3 - Correction of Abs600 measurement
Correction of Abs600 measurement
Table 4 - Raw data of fluorescence measurement
0 2 4 6
Negative Control CLONE 1 1.08025 2.16875 16.13602 29.83945
CLONE 2 1.96175 1.974 19.02202 32.08245
Positive Control CLONE 1 13.218 157.839 413.9833 493.0602
CLONE 2 19.26725 178.7663 485.3383 578.5027
Test Device 1 CLONE 1 203.4893 515.1385 1366.608 2527.968
CLONE 2 216.369 550.578 1161.084 2002.293
Test Device 2 CLONE 1 52.94075 330.942 1212.613 1625.767
CLONE 2 57.626 300.5665 1104.674 1431.868
Test Device 3 CLONE 1 2.81475 4.924 32.52677 47.32195
CLONE 2 3.3015 4.3785 31.76152 56.2147
Test Device 4 CLONE 1 2.65525 6.173 34.00727 45.5552
CLONE 2 2.00575 5.008 37.20552 51.47795
Test Device 5 CLONE 1 19.70225 167.6278 435.9625 529.8542
CLONE 2 17.1425 140.0155 430.8645 498.9205
Test Device 6 CLONE 1 3.124 5.37275 19.22877 30.8587
CLONE 2 1.186134 5.4735 27.23052 39.53995
This is the average of each clone, click here to see the original data. [Excel file]
Figure 4 - Correction of fluorescence measurement
Correction of fluorescence measurement
Table 5 - Raw data of Fl/Abs600
0H 2H 4H 6H
Negative Control Colony 1 0.0049 0.0021 0.0066 0.0091
Colony 2 0.0080 0.0019 0.0070 0.0095
Positive Control Colony 1 0.0559 0.1265 0.1525 0.1303
Colony 2 0.0866 0.1422 0.1501 0.1493
Test Device 1 Colony 1 0.9270 1.1547 1.1894 1.2126
Colony 2 0.9366 1.4767 1.3349 1.2506
Test Device 2 Colony 1 0.2177 0.2875 0.3997 0.4487
Colony 2 0.2583 0.3105 0.3807 0.4273
Test Device 3 Colony 1 0.0118 0.0038 0.0104 0.0133
Colony 2 0.0166 0.0036 0.0102 0.0150
Test Device 4 Colony 1 0.0114 0.0050 0.0109 0.0130
Colony 2 0.0089 0.0042 0.0120 0.0146
Test Device 5 Colony 1 0.0710 0.1324 0.1375 0.1449
Colony 2 0.0685 0.1269 0.1476 0.1476
Test Device 6 Colony 1 0.0113 0.0039 0.0064 0.0088
Colony 2 0.0055 0.0046 0.0087 0.0114
This is the average of each clone, click here to see the original data. [Excel file]
Figure 5 - Average level of devices
Correction of fluorescence measurement
Conclusions
It is noticeable that the promoter of the Device 1 is the strongest followed by the promoters of the devices 2 and 5. But the device 3, 4 and 6 are not active.

Methods & Materials

Strain used: E. coli DH5-alpha

Plasmid DNA (100 pg/uL in 10uL of water)
Positive Control (BBa_I20270): J23151.B0032.E0040.B0010.B0012 in pSB1C3 Negative Control (BBa_R0040): R0040 in pSB1C3 Test Device 1 (BBa_J364000): J23101.B0034.E0040.B0010.B0012 in pSB1C3 Test Device 2 (BBa_J364001): J23106.B0034.E0040.B0010.B0012 in pSB1C3 Test Device 3 (BBa_J364002): J23117.B0034.E0040.B0010.B0012 in pSB1C3 Test Device 4 (BBa_J364003): J23101.J364100.E0040.B0010.B0012 in pSB1C3 Test Device 5 (BBa_J364004): J23106.J364100.E0040.B0010.B0012 in pSB1C3 Test Device 6 (BBa_J364005): J23117.J364100.E0040.B0010.B0012 in pSB1C3

Materials
FITC Standard: one tube with dried down FITC for creating a FITC standard LUDOX: one tube with 30% colloidal silica suspended in 1mL of water 1xPBS (phosphate buffered saline) LB (Luria Bertani) media Chloramphenicol (stock concentration 25 mg/mL dissolved in EtOH) 50 ml Falcon tube (or equivalent) or 250 ml shake flask for cell growth 1.5 ml eppendorf tubes for sample storage Ice bucket with ice Pipettes Black 96 well plate
Machines: SpectraMax M5, SPX-150B-Z biochemical incubator and THZ-312 Thermostatic oscillator Software: Microsoft Excel and pro5 Calibration: OD600 Reference point and FITC fluorescence standard curve Cell measurement: Transformation and Measurements Protocol for calibration and measurement Raw Data
Ignis Fly

Tongji_China iGEM 2017 Team
Processchevron_right